The cat genome: what does it say about domesticated moggies?

November 16, 2014 • 8:56 am

Not much, really, though there are some interesting but preliminary findings.

Many readers sent me a link to a new paper in the Proceedings of the National Academy of Sciences by Michael J. Montague et al. (reference at bottom, free download, too many authors to list!), and I found it interesting but not definitive. That’s not the authors’ fault, for there’s only so much you can say about the evolution of Felis silvestris catus from sequencing its genome and comparing it to genomes of other mammals. And, of course, cats have been domesticated for only around 10,000 years, so there hasn’t been much time for evolution, especially because artificial selection practiced on cats has been less intense than that practiced on dogs. Cats, after all, are still semi-feral, not much removed from their wild ancestor, the Middle Eastern subspecies of the European wildcat (F. s. lybica). And they keep escaping and mating with their wild ancestors, unlike dogs.

I’ll try to be brief. The authors sequenced the entire genome of a single female Abyssinian cat named “Cinnamon.” After arduous effort, I found a picture of the actual Cinnamon. Here she is, from the IFL Science page:

CINNAMON
photo credit: Cinnamon / Kristina Narfstrom, University of Missouri-Columbia via National Human Genome Research Institute

Cinnamon’s genome contained 19,493 genes that are predicted to code for proteins, not much different from the 20,000 protein-coding genes estimated to constitute the human genome. Cats, in other words, have about as many genes as we do. That’s no surprise as lots of animals that we see as “simple,” like fruit flies, also have numbers of genes similar to that of humans.

The authors were most concerned with which genes in the domestic cat lineage—as well as in the felid lineage (about 36 species) and the carnivore lineage—had evolved by natural or artificial selection. Geneticists determine this by looking at those genes that appear to evolve faster than the “normal” turnover of gene sequences by nonselective processes such as genetic drift. Those genes that show a higher proportion of “coding differences” (DNA sequence differences that change the sequence of their protein product) compared to “noncoding differences” (those changes in the DNA sequence that don’t affect the protein that a gene produces, and there are many such changes), are presumed to have evolved by selection. The authors thus compared the “selected” genes in domestic cats to those of other felids, and then to those of other carnivores, and even further, to those of non-carnivorous mammals, by comparing DNA sequences of cats to tigers, to dogs (carnivores), and to humans and cows (noncarnivores).

The rather complicated diagram below shows the evolution of genes in house cats compared to other felids and carnivores (dogs), and to felids in general compared to dogs. The numbers in the boxes at the node (826 and 779) represent the number of reconstruced “olfactory receptor genes” (those involved in smelling different odors) in the ancestral carnivore and felid, respectively. They don’t differ much, although there’s been a slight decrease in felids.

The pie charts show the V1R genes (“vomeronasal genes,” used to detect chemical scents, probably of conspecifics) and “Or genes” (olfactory receptor genes, used to detect odors in general.) The numbers on each branch reflect the gain of Or genes since the common ancestor (in green) and loss of Or genes (red). “Pseudogenes” are genes that have become nonfunctional.

Screen Shot 2014-11-16 at 7.08.54 AM

As you can see:

  • Since the divergence from the common ancestor with other carnivores, felids have lost more of their Or genes, reflecting, perhaps, a lesser reliance on detecting prey and the environment with scent as opposed to vision and hearing.
  • Felids, however, have retained more of their V1R genes, perhaps reflecting the need to detect conspecifics for both mating and avoidance, as cats (except lions) are nonsocial and must learn each other’s territories (through scent-marking).The authors suppose that the relative gain in V1R genes and loss of Or genes in felids reflects their greater reliance “on pheromones for sociochemical communication.” You may have seen your cat use its vomeronasal organ when sniffing the dried urine or scent of other cats: it opens its mouth and appears to go into a trance as it absorbs and analyzes scents through the organ, located in the roof of its mouth. This is called the “flehmen response” by animal behaviorists.  Other animals do it to, but especially felids.

Here’s a cat showing the flehmen response, opening its mouth to let odors enter the vomeronasal organ:

The figure also shows the genes that look as if they’ve been subject to positive selection (in the case of dogs and house cats, that could be artificial selection) in that lineage. Here are a few other genes of interest:

  • Cats have lost the ability to synthesize many fatty acids compared to other carnivores or mammals. The authors suggest that this is because cats get plenty of fats from their carnivorous diets. Further, felids show some signs of having genetic changes that render them immune to the heart disease that other mammals (like us) get from eating too much fat. If we could put those genes in humans, we’d be far less prone to heart disease (though we may begin urinating against the walls!)
  • Compared to both wild cats and non-felid carnivores, domestic cats show an accelerated evolution of genes involved in the nervous system: in particular, genes involved in “stimulus-reward learning” and, say the authors, perhaps in tameness.

There are other conclusions as well, such as identification of the genes that cause the “white mitten” pattern of Birman and related Ragdoll cats, as shown below (it’s supposedly due to the combination of two recessive genes).

birman_cat_picture
A Birman with mittens

In general, though, the conclusions are necessarily speculative (after all, they’re based on patterns of gene change rather than actual analyses of gene function). We can say that cats haven’t evolved that much since their domestication, which is what we expect given its recency and the fact that, unlike domestic dogs, cats are still largely feral. In addition, cats roam a lot, and it’s almost certain that some of them have mated with European wildcats (after all, they’re the same species), producing offspring that introduce wild genes back into domesticated cats. That, too, would have slowed down the rate that cats diverge from their wild ancestors.

What we do know is that, compared to other carnivores, felids are more resistant to a high fat diet, show more genetic change allowing them to detect odors of conspecifics compared to odors of prey and the environment, and compared to other felids, domestic cats show neurological changes that make them more amenable to living with humans.

As for the color and pattern differences among breeds of domestic cats, we already know a lot about that from crossing experiments (see here, and here, for instance), though the genes involved in those differences have yet to be identified and sequenced in the genome.

_____________
Montague, M. J. et al. 2014. Comparative analysis of the domestic cat genome reveals genetic signatures underlying feline biology and domestication. Proc. Nat. Acad Sci. USA published ahead of print November 10, 2014, doi:10.1073/pnas.1410083111

43 thoughts on “The cat genome: what does it say about domesticated moggies?

  1. Do we really have solid epidemiology linking high fat diets in humans to cardiovascular disease? I’m first thinking of Inuit and other aboriginal peoples whose diets have significant quantities of fat. Also, since the Nixon Administration’s war on fat, Americans have decreased calories from fat in the amounts we were told to, but incidences of the metabolic syndrome have skyrocketed since then.

    All the data I’m aware of seems to be pointing not to fat but to sugar (in whatever form) as the culprit. The historical rise in metabolic syndrome closely parallels sugar intake, going all the way back to the start of the sugar triangle trade in Colonial times. This is especially pronounced as all the “fat-free” products that have replaced their predecessors and by which Americans have reduced their fat intake…are loaded with sugar.

    b&

    1. As for the aboriginal Inuit diet, from what I have gathered, they ate prodigious quantities of blubber but seemed to suffer no ill effects. It seems to me that the very natural complex of nutrients did not have elements to erode their health, until the inclusion of sugars and starches via white settlers from the south. I’m guessing.

        1. I agree with you, sugar is far more clearly poisonous to people than fat is. If you want to do one simple thing to improve your diet, giving up sugar would be the best advice you could get. Next would be eat more vegetables.

          1. Removing sugar from the diet is not easy for many people used to eating processed food. Just about all processed foods are loaded with it. We make a good effort, but its not easy to get away from the stuff.

          2. Quantity is the key question.

            I personally suggest limiting sugar intake to a tablespoon (~15 grams) per day, which works out to about ten pounds per year, which is about what the average was before the start of the sugar triangle trade and the rise of the metabolic syndrome. That would be a teaspoon per meal, such as one lump of sugar with your tea.

            As I recall, the WHO recommendation is for triple that, or a tablespoon per meal. If you’re eating more than that, that’d be a good initial target.

            Note that a single 12-ounce can of Coke has 39 grams of sugar, or about as much as the WHO recommends at a total sugar limit for an entire day, and as much as I’d recommend for three days.

            Frequency is also worth considering. If you put on an entire tablespoon of sugar total between the tea and cereal but don’t eat any other sugar the rest of the day, that’d be just fine. Or if you don’t do sugar during the week but really lay it on thick for breakfast on the weekends, or other variations on the theme.

            b&

          3. Giving up processed foods also gets you away from all the trans fats and other things that are questionable at the least. The best thing you can do is give up all of that and prepare foods the way your grandparents most likely did.

            That doesn’t mean slaving over the stove all day long. Even bread can be done in five minutes a day, leaving basically no excuse to buy sugar-laden taste-free overpriced commercial bread…at that point, you’re spending almost as much time buying the commercial bread as you would making it yourself.

            Same things apply to all sorts of other foods. I can make a pizza, including sauce and dough, in not that much more time than the delivery time guarantee from the delivery places — though, if I’m not in such an hurry, I’ll let the sauce slowly reduce for a long time. It’s about as fast for me to make fettuccine Alfredo from flour, egg, cream, butter, and cheese to the plate as it takes to make boxed mac & cheese. Chicken soup spends a fair amount of time sitting on the stove, but my actual time spent cooking can’t be more than fifteen minutes.

            You can eat much, much healthier and better-tasting food for less money and about the same amount of time (though, granted, a bit more effort spent during that time) by cooking your food yourself rather than buying pre-packaged shit (or eating out).

            Cheers,

            b&

          4. My wife refuses to eat out anymore. She finds the food over salted or otherwise not to her taste. She makes good food when she’s not in too much of a hurry. BTW, thanks for the recipes. PS. We do make our own bread using 50% whole wheat which we get by the 50 lb sack from a nearby farm.

          5. I’d agree with her. There are a very few restaurants worth eating at, and basically none of them chains and few of them cheap. The rest, even the inexpensive ones, are overpriced and poor quality. You’ll spend more money for worse food that eats up about the same proportion of your waking hours.

            You might want to think about getting a countertop electric flour mill (about the size and expense of a food processor) and buying not flour but wheat berries from your farmer. The berries, properly stored, will stay fresh literally for millennia, whereas the flour is going to be off its prime before you get to the bottom of the sack. Sifting it for white flour can be a chore, so that may be worth buying as flour…but grinding just to whole wheat flour takes under a minute. And the first time you get a smell of fresh-ground flour, you’ll never want to do it any other way again….

            b&

          6. Stop drinking soda and sweetened ice tea, lemonade, etc. You can probably cut 30-90 grams of sugar a day out of your diet just by doing that.

          7. You don’t mention dropping alcohol as well. It turns into sugar and nasty byproducts. OK, I won’t mention it either.

          8. Again, quantity and frequency matters.

            An hundred milliliters or so of wine with a meal a few times a week very likely does overall more good for your health than ill (and neither all that significant). But a six-pack-a-day habit will do you in sooner rather than later.

            b&

          9. The latter can help a lot with the former.

            If you have a craving for sweets, first eat as many fresh veggies as you can stand to eat; go ahead and stuff yourself silly. Next, if you still have a craving, eat as much fresh whole fruit (not canned nor peeled nor juiced nor sweetened nor adulterated in any other way) as you want. In the unlikely event you still have a craving for sweets, go ahead and knock yourself out; by that point, all the extra fiber in your gut will prevent the worst of the damage from the sugar.

            b&

  2. I remember reading about how Native Americans and First Nations people, as well as Inuits, who follow their traditional ways of eating (from hunting) which comprises a great deal of animal fats from a variety of animals, including uncooked bone marrow and, in the case of Inuits, uncooked fat from seals and whales as well as raw bone marrow, have an extremely low rate of heart disease. They also eat a lot of fish, often “fatty” fish like salmon.

  3. As a high school physics teacher who is on the staff (slave gang) of 2 cats, I would like to thank you for posts like this. I hope it’s ok if I use some of this info in my general-science course*. Using genetics of cats and d*gs seemed to help the students in the biology component.

    *With proper citation, of course.

  4. My cat Mitzy saw the diagram showing that cats and d*gs have a common ancestor and was rather disgusted.

    She asked me this “Why are there still d*gs?”

  5. this reminds me of one of those tear down articles on an Ipad.. Here is the schematic for kitty. It is interesting to see what the specialty differences are – like why humans take a dog along for a hunt – but leave the cat in the barn.

  6. OK, here’s an admittedly weird question: are crows in the process of domesticating themselves? They have moved into human-altered landscapes and show an ability to adapt to human presence. Sure, all they do is eat garbage, but that’s probably how it started with the wolves that domesticated themselves (at least at first) into early dogs. Is eating garbage enough to drive self-domestication, or do crows need to provide some other service to humans? Are the ravens in GAME OF THRONES corvids that have undergone domestication? (In case you don’t watch the show, the ravens carry messages.)

  7. We thought this was an excellent posting. As biologists we’re interested in cats biology. Thank you.

  8. I still find it odd that even though there seems to be as many “cat people” as “dog people”, we still have basically one cat for the most part whereas there are so many different dogs. Surely they’ve been around for a comparatively similar amount of time yet there are no large cats for herding or retrieving. Cats made good mousers but that seems to be about it. Seems like one should be able to artificially select to make big cats but WDIK? This may be off the above topic but I find some of your science way over my head anyway but have always wondered about this.
    Here’s Darwin’s take on it from The Origin of Species:
    On the other hand, cats, from their nocturnal rambling habits, cannot be matched, and, although so much valued by women and children, we hardly ever see a distinct breed kept up; such breeds as we do sometimes see are almost always imported from some other country, often from islands. Although I do not doubt that some domestic animals vary less than others, yet the rarity or absence of distinct breeds of the cat, the donkey, peacock, goose, etc., may be attributed in main part to selection not having been brought into play: in cats, from the difficulty in pairing them …

    1. In fact, there is such a thing as “cat breeder” so cat breeds can be “kept up”. Fact is, most cat owners are very happy with open-bred kittens — and a bit shamed to buy a kitten from a breeder when thousands of unwanted cats and kittens are warehoused or killed in the local shelters.

      Our present cat is as “different” from over-the-fence bred as, say, most kinds of small purebred terriers are from an open-bred “rat-dog”. She’s Manx [single-dose dominant, homozygous lethal with various modifiers of the skeletal structure, not just tailless], semi-longhair [eg, seasonally variable] with angora undercoat and Van white/piebald pattterning. There are a number of behavioral traits that were also deliberately selected for. This was all human controlled, and pretty comparable to the way many AKC breeds originated in the 19th and early 20th C.

      Our last cat was an open-bred “Maine Coon”, big and furry, but hardly comparable to the 30 pound lynx-with-tail show Maine Coons. Again, although our present cat was an adult adoptee from the local shelter, most adoptions are kittens. And for most cat owneres, there’s little selection criteria beyond purring when they’re picked up at that stage. Don’t ask me about dog owners and puppies— different species.

  9. Very interesting. Thanks for putting this study into (relatively) layman’s terms. I’ll look at my two cats a wee bit differently now.

  10. Is there a way, using this type of analysis, to differentiate between artificially and naturally selected genes? Maybe the pool of alleles for an artificially selected trait would be larger than the alleles for a naturally selected trait, because the selection pressure would be less dire; having the wrong artificial trait means someone is trying to stop you from breeding, and having the wrong natural trait is an actual decrease in fitness.
    Or, do you have to know what the gene does in order to determine if it is likely artificially or naturally selected?

    1. One can get an idea of how long it took the selected gene to reach fixation (if it takes a long time, crossing over will associate various parts of the genome with it, so the surrounding DNA region should be more diverse; if it is short, you’ll basically see no variation around the selected gene). Since artificially selected genes are usually fixed (present in all members of the group) very quickly, one can get an idea from the lack of variation that humans had a hand in their fixation.

    2. Is there a way, using this type of analysis, to differentiate between artificially and naturally selected genes?

      If the selection pressure is caused by the Homo sapiens, it’s artificial. If it is caused by any other species or environmental influence, it is natural. To me the distinction appears to be (wait for it)
      artificial.

  11. I have a couple of questions for those who are better versed in genetics/animal behavior.
    1) From what I get from the article, cats are genetically predisposed to conspecific anti-social behavior. Yet, as a decades long cat staffer, I have found that to be a very individualistic trait. Some the moggies I have had have been very accepting of new comers (a lot of play and mutual grooming) while others have been very stand-offish. So my question is, is this probably due to genetic variation or can environment curb this genetic disposition? Note: All of my cats through the years have been spayed females, adopted from shelters.

    2) Does the fact that cats come from a long evolutionary line of pure carnivore, where as the introduction of meat to the primate diet was relatively recent, shed any light on the fact that felids have lost the ability to construct fatty acids while primates still retain it? I guess what I’m really asking is, what is the evolutionary cost of being able synthesize these compounds, even if you no longer need to?

    Thanking everyone in advance for information.

    JH

  12. As Baihu was licking the cream off the whisk a little while ago, a thought occurred to me: does this study say anything about genes for lactose tolerance?

    Seems to me that that’d be an excellent proxy for all sorts of domestication-related subjects.

    b&

  13. This was interesting, but made my between-the-eyebrows lines deepen just a wee bit trying to follow. I liked the Flehman response video. I had to look up definition for *conspecific* — but now I know!

  14. Back in 1979,in Godel, Escher, Bach/, Douglas Hofstadter apparently had already sequenced part of the cat genome.

    There is another (extremely faint) possibility: that we could learn to read the phenotype off the genotype without/ doing an isomorphic simulation of the physical process of epigenesis, but by finding some simpler sort of decoding mechanism. This could be called “shortcut pseudo-epigenesis”. Whether shortcut or not, pseudo-epigenesis is, of course, totally beyond reach at the present time–with one notable exception: in the species Felis catus\. Deep probing has revealed that it is indeed possible to read the phenotype directly off the genotype. The reader will perhaps better appreciate this remarkable fact after directly examining the following typical sectiion of the DNA of Felis catus/:

    …CATCATCATCATCATCATCATCATCATCAT…/

  15. Are the fatty acid deficiencies the absence of this or that desaturase? I’d read the paper if it was available.

      1. I had hoped to avoid that, figuring it was going to be deeply buried in the legend to some figure. But now with PDF in hand, I see I had a lucky guess. Cats have esp low arachidonic acid levels as a result of low Δ-6-desaturase activity.

  16. I don’t see a free download link on that site? It says I need a subscription. Would it be possible to get the paper from you? Seems like a interesting read.

Comments are closed.