I’ve been pretty hard on Francis Collins, what with his mixing faith and science and telling people that there’s empirical evidence for God’s existence. But that makes it extra incumbent on me to give him kudos when he does something right. I mentioned the other day his support of stem-cell research, which is discussed in a new article, “The Covenant,” in The New Yorker. Maybe I was too eager to get in a lick against Christianity, so let me say that I much appreciate his going to bat for good science and humanitarian medicine. And then there’s this:
Collins strongly disputes that assessment [Craig Venter’s pronouncement that the Human Genome Project has contributed little to medicine]. He says that after reading the Times story he sat down and wrote out a list of breakthroughs directly attributable to the advances in genomics, among them providing new understanding of age-related macular degeneration, Crohn’s disease and the role of autophagy, and Parkinson’s disease and the central role of alpha-synuclein aggregates; and the development of a recent drug for lupus. “It’s revolutionized everything that we do,” he says. He has discussed some of this with his friend the militant atheist Christopher Hitchens: “As you might have heard, Christopher has esophageal cancer, and I have actually been spending a fair amount of time with him and his wife, Carol, trying to help him sort through the options for therapy—including some rather cutting-edge approaches based on cancer genomics.”
I’m not going to pull my punches if Collins continues his public harmonizing of science and faith, but any Christian who would try to cure the world’s most vocal atheist is a Christian I can appreciate—and live with.
This was a very good post; it’s always nice to see individuals in rival ideological camps appreciating each others’ shared humanity.
Francis Collins seems like a decent person, and–insofar as his faith will permit to be–largely intellectually honest.
Somebody should send him a pake.
This makes me think: what type of research is most in danger of being negatively affected by Collins’ theology? He obviously doesn’t believe in immediate ensoulment of an embryo. How could his thoughts on God’s interventions in evolution – adding the moral sense to make us human is one – play out in deciding what research to fund? (imagine if he had sole and final say)
Glad to see you reeled in the schadenfreude from your earlier post on stem-cells.
Well, as Chris Rocks would say, let’s not give people too much credit for doing things the they’re supposed to do. The Hippocratic oath applies irrespective of religious belief, no? Aw, maybe I’m just in a cynical mood today. Don’t mind me…
I meant “Rock.” His name is Chris Rock, obviously. I do think he rocks, though.
Collins is a PhD I believe, no oath-taking involved with getting that.
No, he’s an MD as well. And even if he took that Hippocratic oath, that doesn’t oblige him to go out of his way to help cure someone when Collins isn’t even practicing as a physician.
As I said, I’m in a cynical, uncharitable mood today. It probably has to do with the fact that Collins has annoyed me too many times in the past for me to view him with any kind of objectivity. (When I read The Language of God, I thought my head was going to explode.) I admit it: For all his contributions, I can’t stand the guy.
ditto.
If you’ve ever seen him speak at conferences, you’d probably be trying to get as far away from him as possible.
irritating blowhard, has been my experience.
My take on this is much less charitable. Having known personally a previous director of NIH, Collins is being entirely logical in stumping for stem cell research. He knows where his grass roots support actually lies, and for THAT position, it ain’t with the fundies.
He has nothing to lose by ignoring them.
Good. If we’re going to knock him when he screws up, it’s only fair to praise him when he does something right.
Yes, thanks, and by all means. If only the gods were as decent as some of their followers appear to be, huh?
Collins is friends with Hitchens??
That’s news to me.
The HGP has had medical applications-not all of them directly translating into therapeutics at present. However, I think “It’s revolutionized everything that we do” is a little over the top.
“Collins strongly disputes that assessment [Craig Venter’s pronouncement that the Human Genome Project has contributed little to medicine].”
I’d be interested in reading Craig Venter’s rational, reasonable justification for his claim, if that justification exists and if anyone can provide a link.
Whatever Venter’s intellectual curiosity as a scientist and altruistic predisposition toward humankind, my incomplete, imperfect perception is that his main motivation for identifying the human genome has been and is financial gain (else why compete with Collins’s governmental effort?), presumably from ensuing advances in medicine. Have his and his investors’ investments been for naught? (I assume that he had to get financial backing from investors.)
It was in an interview following the synthetic genome thing. Here’s the URL:
http://www.spiegel.de/international/world/0,1518,709174,00.html
He doesn’t make a good case for that conclusion at all; he just contrasts the more enthusiastic predictions of geneticists in the 1990’s to what actually happened. Reality, of course, fell pretty far short of the possibilities. But Collins’ short list shows that “not as much as hoped” is a great deal more than “nothing at all.”
Also, he does talk a little about the private vs. government efforts and why he decided not to join the government effort, IIRC.
It’s something that’s difficult to evaluate; I doubt Venter put any thought into quantifying things. I suspect he was probably thinking about all the hype at the time (a cure for all cancers within the decade, gene therapy, etc) and after all these years absolutely none of the hype has shown any truth to claims. The information will be useful as scientists make sense of it but that’s about it – the usual slow march of progress. Well, thanks to a lot of automated processes developed by people like Venter, scientists are able to test ideas much quicker than ever possible before – many years of work can essentially be done in a few weeks.
Venter is just pointing out that things are way more complicated than was acknowledged when the human genome projects were underway, and that it’s fair to chastise Collins for his role as cheerleader for genomic medicine, real progress notwithstanding.
“Maybe I was too eager to get in a lick against Christianity…”
As a progressive Christian I dismiss your “licks” against Christianity because I don’t think you know what Christianity entails. Your focus seems to be on the literalist, fundamentalist, creationist version of Christianity. Fine. That’s your privilege.
That focus is a bit like considering Helium as the only element in the periodic table because it makes one talk funny.
I dismiss your “licks” against Christianity because I don’t think you know what Christianity entails.
this is either the beginning of a Courtier’s Reply, or a no True Scotsman argument.
either way…
Whatever that means.
The Courtier’s Reply – Saying that because of our non-belief in the Emperor’s New Clothes One True God, our opinions on it are invalid because we could not possibly appreciate it.
No True Scotsman – The literalist fundies aren’t True Christians anyway.
Throw in an “atheists are angry at god”, “commies were atheists and they killed millions” and “atheists don’t want to be moral”, and we could practically complete our apologist bingo cards.
Okay, I guess I fail at strikethrough. Emperor’s New Clothes was supposed to be
striked.My personal favorite is the great apologist trump card of “Why is there something instead of nothing, hmmm?” There really is nothing quite like the glib self-satisfaction of someone springing that question and thinking you’ve never heard it before.
Someone should do a Top Ten list.
The Ten Con-arguments?
You obviously don’t understand much of what you read then. Christianity is bullshit – there is no god. Nor is it only the fundamentalists obstructing learning by giving people weird ideas. For example, let’s take the topic here – embryonic stem cell research. The catholic church is against it because it will “destroy a life” as they claim, which is nonsense. If you believe that the research was banned in the USA because of a minority of fundamentalists then you have a pretty strange notion of how things work. I’m afraid that you’re the one who doesn’t understand christianity.
As someone with a scientific bent–as I am guessing you are–I would expect you to cite at least one reference for your insights into Christianity.
My references are the Roman Catholic Church, especially Vatican II, and the Westar Institute. Compare these with the literal reading of the Bible of creationists and any conclusion other than that Christianity defies definition is to ignore the evidence.
I would think someone who is aware of twenty first century science would take the time to read some twenty first century Christian scholarship. I suggest you begin with The Five Gospels by Robert Funk.
One flaw in the science v. religion faux debate is the easy acceptance of differences among scientists and the ignoring of differences among religions scholars.
One flaw in the science v. religion faux debate is the easy acceptance of differences among scientists and the ignoring of differences among religions scholars.
Ken Miller is a Catholic.
Ken Miller says he’s not a creationist, and often debunks YEC nonsense.
Ken Miller also thinks god operates through quantum fluctuations.
what part of Catholic Dogma is that again?
Ken Miller is a scientist, not a religious scholar. There are widely differing views among Christian scholars, to isolate one group, none of whom I would call scientist’s, yet every one of them accepts science as it is revealed.
As for Catholic Dogma, it is so widely diverse as to prove the point that religion is subjective.
I know not what Ken Miller thinks about God, but the Christian scholars I prefer have either dropped the God reference or changed its meaning to equate with the transcendent.
The most radical of these is Don Cupitt who writes,
“Life is God. Life is that in which ‘we live and move and have our being’ (Acts 17:28), within which we are formed, and of whose past we will remain part. Both our ultimate Origin and our Last End are within life. Life is now as God to us.” at
http://www.doncupitt.com/philosophylife/don-cupitt-philosophy-of-life-religion-of-ordinary-life.html
Every Christian Scholar I know knows Don. He may be the benchmark progressive Christian and like any committed enquirer, he seeks a personal truth.
Ken Miller is a scientist, not a religious scholar.
again, is this a courtier’s reply, or a no true scotsman argument.
I can never tell.
Ken Miller is a scientist, not a religious scholar is a factoid.
the problem is, it’s irrelevant.
If Ken Miller was professionally trained as a theologian, and made the same exact argument (and he didn’t pull that argument out of his ass, you know), would that impact the merit of his argument?
you’re reliance on authoritarianism is charming.
Why criticize the Emperor’s new clothes until you have read up on the latest thread patterns of Emperor’s Clothes?
Why not start simple and present all your evidence for this god you follow. Without that, we can ignore the rest as meaningless twaddle.
You missed the previous and current pope poo-pooing embryonic stem cell research? Let’s see – I wonder what the documents of the Second Vatican Council have to say about it – probably nothing at all because the topic was unheard of by church officials back then. Besides, the dictates of an ecumenical council are not the only source of rules in the church – there are papal bulls and various other documents as well. But anyway – please do point out which part of Vat2 documents say “we support embryonic stem cell research” because all the statements issued by the pope’s office in the past 10 years have been anti-embryonic stem cell research.
In case you actually want to read on contemporary issues in the catholic church as opposed to merely historical issues, try reading “Dignitas personae” – I believe the text is available on the web. Read it, and then tell me the goddamned catholic church isn’t obstructing research just like the fundamentalists.
I didn’t miss it, I absolutely agree that embryonic stem cell research should be allowed, even encouraged. It doesn’t take a genius to recognize that destroying several hundred thousand frozen embryos annually through research or flushing them down the drain is the same thing, destroying embryos.
Religious objections to embryo destruction should be consistent. The question is, “When does a human life begin?” I think Roe v. Wade got it right and that frozen embryos are not human life.
Citing one situation to criticize an entity is flat wrong, just as condemning science because one scientist falsified research.
That’s a funny method of thinking you have there. Just to be clear, the TOP HONCHOS of the catholic church say that human embryonic stem cell research is EVIL. They do not say that catholics may choose to believe so based on their conscience (which the last honest pope, Paul #6, said about condoms – that it is up to the individual and their conscience to decide to use ’em little rubber things). No, the current chiefs are insisting that everyone should believe that the research is evil – dehumanizing – etc. So if you don’t agree with them, then what the fuck constitutes catholicism? Who the fuck is the catholic church? Its like saying “I’m a good little Lamarckian, but I don’t believe in Lamarck’s ideas about heritability of traits”.
Getting back to the point: the catholic church as an institution is not considered “extremist” by any government on the planet, and despite your assertion that only the “extremists” oppose the research, the fact is that the catholic church actively opposes it as an institution. To claim that it doesn’t just because some members will invariably ignore the church on that matter, is facetious at best.
I actually think it rather unfortunate that, given its history, more governments DON’T think of the CC as extremeist.
How many churches can go to a foreign country, a country in like Africa let’s say, and have enough authority to basically dictate policy there.
Every single one of them.
In case you missed it, the Catholic Church is not the end all of Christianity. If they were so concerned about an embryo being a human life they would be denouncing the idea of harvesting embryos, knowing that those unused, abandoned, would be discarded, murdered.
In case you missed it, the Catholic Church is not the end all of Christianity.
point went right over your head I see.
For “…progressive Christian”
I read: “tax-dodging illogical hypocritical mental-infant who provides cover for the extremists”.
And that’s when I’m in a good mood.
Nothing like a calm discussion.
Not a scrap of evidence for this ‘genocidal misogynist sky-daddy stand-over thug’ of yours yet, I note.
Until that unlikely eventuality, I am not obliged to remain calm. In fact, I find myself obliged to rage in a similar manner to those who raged against slavery, and those who raged against male domination of women.
(Both of which were solidly based upon your pet delusion)
that’s better.
…
*reins in snark*
…
Okay, cool. I can go with that.
So – you’ve said that our definition of Christianity is wrong, thus dismissing our contribution to the conversation – from your point of view, anyway.
Care to offer one that’s right? It’s kind of hard to respond to you if we have to take wild stabs in the dark.
If Helium makes you yawn then show us some carbon already.
And if you do show us some carbon and we point out some problems, don’t go pretending you were all about sodium all along, either. It’s annoying.
I’m not saying your definition of Christianity is wrong. I’m saying it’s limited. Since there is no defining Christian authority, it requires some definition. As has been stated here before “depending on how you define” applies to religion and species as I recall also applies to Christianity.
The most vocal advocate is not always the best reference in many areas. In Christianity, it may be the worst because the most vocal–creationists–are the most threatened, not only from without, but from within Christianity. When your former peers become your detractors you may circle the wagons.
I’m not saying your definition of Christianity is wrong. I’m saying it’s limited.
Still not able to differentiate between the no True Scotsman argument and the Courtier’s reply yet…
hmm, maybe if i asked a question directly:
would you say that a creationist is not a true xian, or would you say that the atheists here simply are unaware of the “vast and complex theology” that is at the root of your particular religious beliefs?
In answer to your final paragraph. It is not for me to say because there is no definition of what a true Christian is any more that there is a concise definition of what a true species is. As the WEIT master himself has said, “it depends on how you define species” which should be easier to do than defining Christian.
I would not say atheists are unaware of the ‘vast and complex theology’ (your words, not mine) because there isn’t one. The root of religious belief is personal. Of course it depends on what is meant by religion and there is no tidy definition for that. I prefer Lloyd Geering’s definition, “Religion is a meaning system” which means it is neither theistic nor non-theistic.
IOW, you have no logical or rational argument in support of your beliefs, and can’t even define them.
thanks.
That’s correct, the religious experience is non-rational and beyond proof, that’s why they are called belief, meaning a personal “truth” without evidence; e.g., “I know my Mother loved me.”
your mother never hugged you, did she.
I do know what Christianity entails and that was one of the reasons I lost my faith. Get into an argument about the Bible with me and prepare to lose. You may be one of the “nice,” “progressive” Xtians like Collins. However, from numerous polls, ARIS, PEW, etc. it is “the literalist, fundamentalist, creationist version of Christianity” (i.e. like Beck, Palin, Graham, et al.) that has the greatest numbers and make the loudest noise and is hell-bent on turning our Democratic Republic into a fascist theocracy. The “moderate,” “progressive” Xtians are an impotent minority among your fellow believers, just as the “moderate” Muslims are far outnumbered by, and therefore impotent to resist, their (only slightly) more barbaric brethren. We nasty atheists are not the bearers of the brush that is tarring your image. Your fundamentalist, Dominionist, Reconstructionist co-religionists are the ones making you “moderates” look bad and if that is a problem for you, take it up with them. If you leave it up to others to fight the, in Isaac Asimov’s phrase, “armies of the night” so humanity does not sink into yet another dark age, do not come crying to us if your feelings get hurt.
Consider this fair notice that the degree to which you and your fellow moderates do or do not LOUDLY and PUBLICLY oppose, denounce, and shame the religious barbarians for whom you currently provide cover, will reflect directly on others estimates of the character of you as an individual and of Christianity as a whole.
First Pharyngula, then WEIT: must all Gnu Atheists be nice to Collins? How will we be able to recognize the “dicks”, then? 😉
Hey, Oldfuzz. If by “Christianity” you mean something like “a beautiful poem with no factual content that can be refuted or defended that makes me feel good inside,” it’s unlikely very many of us would feel the need to get licks in. But that’s not what even YOU mean, is it?
The thing about Helium and talking funny was just weird.
That what faith does to one’s logic, I’m afraid.
Even if said blind faith puts on a modern dress and calls itself a fancy name.
Nothing like a clear argument to advance differences of opinions.
so far, it appears you’re a master of posting unclear arguments, so I’m not sure to take your word that you recognize what a clear argument is.
He’s got tone trolling down pat, though.
Having whacko ideas doesn’t mean someone is evil and you’ll get good people and bad people in any group on the planet. I just don’t want Collins using his position to tell others that there is a god etc, not even if he thinks god wants him to. He’s welcome to do that in his own church – as long as he doesn’t insist that science and religion can get along etc.
…and I don’t want Collins using his belief in duality and “Moral Law” to start curtailing funding for cognitive research and psychology while everyone focuses on his public fight for stem cell research, either.
no, this idea that “Collins is OK” is knee-jerk, and when the backlash settles, Jerry and PZ will come back round to actually thinking about this guy critically again.
Why do you think he wants to curtail cognitive and psychology research?
he’s previously mentioned publically he thinks research into cognition is a waste of time, because all of consciousness is derived from God.
he also says this in his book.
seems a logical conclusion that he would then oppose funding research in opposition to his public stance on the issue.
whether he IS or not is a question I can’t answer without looking at what he’s actually done as director of NIH, and those records aren’t all that easy to obtain, or in some cases, even obtainable.
all one can do is rely on what people within the dept. are saying about his directions and focus, and not being in direct contact with the dept. anymore, I have no direct info.
Like I said, I can only base my fears on his public statements.
Thanks; I was going to ask if Collins had The Truth about cognition but thought that would sound too facetious. That’s certainly bad news; it’s not that long ago that the church knew that the earth was flat.
For the same argument (about cognition) for just the opposite reaason please read: Lewontin, R. C. (1990), ‘The evolution of cognition’, in Thinking. An Invitation to Cognitive Science, Volume 3. Edited by Daniel N. Osherson and Edward E. Smith. Cambridge, MASS: MIT Press
Because he doesn’t seem to see any merit in certain types of psychology research. Sam Harris wrote about this last year in a very convincing manner. From his article on Project Reason’s website:
Collins has written that “science offers no answers to the most pressing questions of human existence” and that “the claims of atheistic materialism must be steadfastly resisted.” One can only hope that these convictions will not affect his judgment at the NIH. Understanding human wellbeing at the level of the brain might very well offer some “answers to the most pressing questions of human existence”—questions like, Why do we suffer? How can we achieve the deepest forms of happiness? Or, indeed, is it possible to love one’s neighbor as oneself? And wouldn’t any effort to explain human nature without reference to a soul, and to explain morality without reference to God, constitute “atheistic materialism”? Must we really entrust the future of biomedical research in the United States to a man who believes that understanding ourselves through science is impossible, while our resurrection from death is inevitable?
That’s the last paragraph. The whole article can be found here: http://www.project-reason.org/archive/item/the_strange_case_of_francis_collins2/
thanks Andrew, that was one of the articles I was thinking of, but didn’t have the link.
lest we forget WHY many of us still think Collins is NOT “OK”:
http://scienceblogs.com/pharyngula/2009/07/collins_gets_panned_almost_eve.php
http://home.planet.nl/~gkorthof/korthof83.htm
just like one bad idea/position by Collins doesn’t make him a complete idiot (Moral Law doesn’t negate his fine discussion of the role of the human genome project as evidence for common descent), likewise one public position one tends to agree with doesn’t make him “OK” either.
A bit Manachean in your thinking there, aren’t you Ichthyic? Isn’t it possible to compliment a man’s decent act while still disagreeing with some or most of his ideas? I’d like to think so. I’ll join you in calling many of Collins’s notions irrational and possibly dangerous, but I think it goes to far to then imply that everything about the person must be damned.
A bit Manachean in your thinking there, aren’t you Ichthyic? Isn’t it possible to compliment a man’s decent act while still disagreeing with some or most of his ideas?
and where do you see otherwise? Did I myself not JUST complement Collins on his wonderful presentations on how the human genome project results supported what we already knew about common descent?
I’m arguing against the conclusion that Collins is wholly “OK”, which is the title of this post.
same way I would argue against calling Miller wholly “OK” given his arguments about “god acting in the quantum”, regardless of the great work he has done in shouting down YEC’s and that I still have taught his biology textbook on several occasions.
Your response is rather a strawman, now, isn’t it?
hmm, I’m noticing that maybe you actually were responding to a post previous to the one I was referring to, which for some reason is now awaiting moderation.
so ignore the strawman commentary as you probably didn’t actually see me write the following, which should appear as part of post #12:
“…just like one bad idea/position by Collins doesn’t make him a complete idiot (Moral Law doesn’t negate his fine discussion of the role of the human genome project as evidence for common descent), likewise one public position one tends to agree with doesn’t make him “OK” either.”
Ichthyic, I’m pretty sure we’re on the same side in most of this. Perhaps the entry title could have been more artful, but it’s a little hard to imagine that regular readers were to take from it that now Jerry was issuing a blanket approval of all things Collinsy. How about we let the religious do the fighting amongst themselves and we not automatically assume the worst of each other? I didn’t mean to construct a straw man, and you have a good point…but your tone does not seem to me wholly justified given the offense.
see my response to my response to your response above.
🙂
And ever after it was said of them that they became the most famous of friends.
Just crossed wires…it’s all good.
Happy, Happy!
Yay! Collins is doing his well-paid and prestigious job properly, and isn’t letting his belief in bronze-age mythologies interfere with it! Let’s hold a parade!
Seriously, it is only a profound sense of relief that Collins didn’t fuck things up that makes this noteworthy in any way whatsoever — we’re like battered spouses who thank their partner for not beating them. Jerry would not have responded with such warm praise to any past NIH head who went “to bat for good science and humanitarian medicine” — that’s his fucking job.
we’re like battered spouses who thank their partner for not beating them.
I like that analogy.
If he didn’t help his friend I would need to downgrade my opinion of christianity yet again and there isn’t much left on the downside.
I don’t dislike christians because of what they believe in relation to their own life but because of how they reflect that belief on those that don’t share their delusion. I expect a decent person that is also a christian (almost oxymoron) to be vocal against public or governmental practices that discriminate against atheists, gays, women and others that don’t enjoy being stepped on by christians. Certainly there are some KMs and Phils that enjoy being subservient but that position can be “accommodated” without the discrimination towards those that don’t want it.
Thank you may seem shallow after that but I do sincerely thank you Francis Collins for any help you provide to the truly lovable Christopher Hitchens.
Not to belabor a side point, but where again did Dr. Collins himself say that research on cognition and psychology is a waste of time and should be curtailed? All I see in the Sam Harris piece that was cited above is speculation about what Dr. Collins might do if the subject comes up during his tenure at NIH.
Not to belabor a side point, but where again did Dr. Collins himself say that research on cognition and psychology is a waste of time and should be curtailed?
but you are.
have you read his book?
Yes, but I don’t have it in front of me. (I checked it out of library when his nomination was under consideration, and it didn’t seem worth buying.) As I recall, he had one chapter where he conceded that if evolutionary psychology could account for human morality, his argument for God would be severely undermined, and he said that the matter should therefore be examined carefully. He then discussed E.O. Wilson a little and seemed to let the issue drift away. But I don’t remember him saying that any funding should be curtailed or that research on psychology is a waste of time. But, of course, I could have missed it. I’m not that science savvy. Just give me the cite. And please don’t bite my head off. I was just asking. It seemed like a pretty amazing thing for a scientist to be saying, if he really did.
All I see in the Sam Harris piece that was cited above is speculation about what Dr. Collins might do if the subject comes up during his tenure at NIH.
why, exactly, do you think Harris was speculating this?
I would point out that the Harris piece is hardly the only reference to Collins’ views on the matter.
look around a bit.
I tried to do a web search, but I couldn’t find it. This internet is confusing for us old folks. Just give me one of those blue thingies that you can click on. I can do that.
Links, that’s what they’re called, links. Give me a link to one of Dr. Collins’ more infamous screeds against cognitive science. C’mon, be a sport.
Thanks for the link (posted elsewhere finally), but it doesn’t do the job. I agree that Dr. Collins’ “moral argument” is unpersuasive. But where in “The Language of God” (or elsewhere) does he say that research which might prove him wrong is worthless and should be curtailed? The only relevant passage I can find implies the opposite: “If this argument [that morality evolved] could be shown to hold up, [my own argument] would potentially be in trouble.” (p. 25). To say (even incorrectly) that the research currently cannot explain morality or altruism (pp. 24-31) is not to say that it NEVER can do so or that such research should not be funded, particularly when Dr. Collins concedes that sociobiology is a “new field.” (p. 25). You’re imputing a closed-mindedness and know-it-all-ness that the whole tone of the book simply does not support.
“you are right to hold fast to the conclusion that science offers no answers to the most pressing questions of human existence”
If Collins really believes that science cannot help with the most pressing questions of humanity I wonder why he has wasted his life on such a worthless enterprise! He should offer his talents to religion if it is so much more valuable.
Just another instance of the religious saying one thing and doing another. They don’t really believe what they say the believe.
With respect, I don’t see the incongruity in this particular statement. To conclude that science currently “offers” no answers to (what Dr. Collins thinks are) the “most pressing” questions is not the same as concluding that it can never, ever, ever reach a point where it offers any answers to any pressing questions. And it certainly doesn’t suggest that science cannot “help” find answers to pressing questions. It seems to me that this particular statement is merely trying to reassure some deeply religious people that science is not their enemy, using “hold fast” language that resonates with a certain kind of conservative Protestant tradition. I’m not saying that tradition is a great one, but it would certainly be a better one if it were not so often on the anti-science side.
Did you miss this quote from Collins, cited above?
“the claims of atheistic materialism must be steadfastly resisted.”
That would include, no doubt, the claim that conscious experience can ultimately be reconciled with a materialistic perspective. But this is exactly what it would mean to study consciousness scientifically.
Not only does Collins think we can’t study the mind scientifically. He seems to think that efforts to do so should be “resisted.”
This seems to me a seriously anti-scientific attitude. I do hope I’ve just misinterpreted every single thing I’ve hear Collins say on this. But I really don’t think I have.
I guess I’ll have to go back to the library and check that sentence fragment for context. To be honest, I didn’t know that “the claims of atheist materialism” was a term of art with such a commonly understood meaning. It seemed sort of vague to me, so I appreciate the help.
And just so I’m clear, this business about the need to resist “the claims of atheist materialism” is the most direct statement Dr. Collins has made on scientific research priorities? I don’t want to drive all the way to library and come to find he wrote an article entitled “Why Research on Cognition and Psychology is a Big Waste of Time and Funding Should be Curtailed.” I’m trying to conserve.
Good news! I’m back from the library (a pleasant drive, thank you very much) and I can report that you silly people have it all wrong if you think “The Language of God” has any harsh words in it about cognitive science (or any other kind of science). None. Zip. Dr. Harris apparently just dug some partial quotes out of context, disingenuously stitched them together, added some inferential neck-bolts of his own, and pulled the sheet away from a monster. You’d think he’d only have been able to scare the children like that, but apparently not. Check the book out for yourselves, if you don’t believe me. I’ll be returning my copy shortly. Yes, it’s still as bad as I remembered it, but it’s not that scary.
heck the book out for yourselves, if you don’t believe me.
we did.
somehow, you must have missed what was wrong with his moral law arguments.
start here:
http://home.planet.nl/~gkorthof/korthof83.htm
scroll down to the section about Moral Law
Hitchens is ‘…the world’smost vocal atheist’.
What nonsense! I have disagreements with Dawkins, but I have no hesitation in saying that he has done more for atheism than Hitchens could ever do.
I know the man is reaping what he has sown and is dangerously ill, and that, consequently, you are throwing him a bone, but that’s going too far.
He’s not even an ‘atheist’ as such, anyway, he’s a self-professed ‘anti-theist’.
Imagine: Hitchens as the main, most vocal representative of atheism – holy Christ, man the lifeboats!
As am I.
But one can be both. Hitchens *is* both. To say that he is not an atheist means that he is is a theist. To claim that CH is a theist is absurd in the extreme.
I can, often do, imagine CH as the main, most vocal representative of atheism.
Do you honestly suggest that as a consequence I should abandon the ship of rational sailors?
Whence doth thou land-of-troll claimest to be born?
“I know the man is reaping what he has sown ”
You ugly, vicious little person.
Josh, I had the same reaction at first, but if, as I assume, that’s a reference to Hitch’s robust smoking and drinking, than Hitch himself has said as much. He said it would be “idle to say otherwise.” That could have been put much more tactfully and without the grotesque biblical alusion, but it could be that NMcC came off worse than intended.
The reap/sow allusion is grotesque indeed (Galatians 6: 7-9).
In that passage, St. Paul is specifically discussing those who “mock God,” implying that such people will basically get theirs—i.e., retribution in the form of eternal damnation. Hitch has indeed said that his illness likely comes as a consequence of his excess drinking and smoking. So in that sense, yeah, he has “reaped what he has sown”—if by that we mean that heavy drinking/smoking do seem to put people at risk for his particular kind of cancer. But the reap/sow figure of speech that has evolved from the biblical original is typically used to imply not mere cause and effect, but rather some sort of cosmic justice. Saying Hitch’s unhealthy choices probably caused his illness is very different from saying that he, or anyone, deserves the immense pain of cancer. And it’s certainly different from implying that he, or anyone, deserves to be tortured for eternity. (I’m agreeing 100% with you Greg, in case that’s not clear.)
I see “militant atheist Christopher Hitchens” in there but I don’t see “militant theist Francis Collins”. The article is obviously somewhat lacking in objectivity.
That is because the epithet means different things when applied to either side.
For theists: it means actual bombings.
For the atheists: it means outlining reality in a non-deferential manner.
OK, he is a good guy. So what?
Seriously, this is the guy who said that DNA is the language of god. Please.
It’s true – have you never heard a Gregorian chant?
AAAAAGAAGAAAGAATAAAGAAACAAATAAA
Great post, Jerry. I agree with you.
To all who have taken more of their time than my posting about Christianity deserves, Thank you for the time. My point about Christianity, as intended, in neither a Courtier’s Reply nor a No True Scotsman argument. It might be better posed as two questions: “What is a Christianity?” “How is that confirmed?”
The same questions can be applied to scientists as well. Recent postings here cited the falsification of data by a scientist. Does this disqualify him from being a scientist? In the flagship book for this blog, Coyne identifies different methods for determining a species, then states clearly which he will use. In Speciation by Coyne and Orr there is a comment as to how definitive the word species is, but this solid work continues.
The same holds true for every field, especially religion where little or no objective evidence can be shown. There is, has always been, an evolution of comprehension within Christian scholarship. Unlike science, where proofs can be verified, religion, including Christianity, can make no such claims.
My point is that there is considerable thinking within Christianity that refutes the creationist mindset and, as is true in science, the advances in thinking come from a few, not the many.
As a simple example I suggest you visit Don Cupitt’s declaration on The Religion of Ordinary Life, a precipitate of a christian scholar who has dedicated himself to pursuing the question. It’s at
http://www.doncupitt.com/philosophylife/don-cupitt-philosophy-of-life-religion-of-ordinary-life.html
We ain’t debating the Emperor’s Clothes until you show us an Emperor.
As a non-theist Christian, I do not believe in an Emperor.
So no Jesus as the son of god, no resurrection, no original sin.
WTF is left?
“So no Jesus as the son of god” No more than any other.
“no resurrection” Nope.
“no original sin” Nope.
“WTF is left?” The teachings which are no better or worse than those of Socrates, Buddha, Lao-Tzu or others. The demands you pose are from the seventeenth century. There have been Christians abandoning them for hundreds of years. We may not fit your definition of Christianity, but, just as I go to people like Jerry Coyne do explain evolution, I go to people like Robert Funk, John Dominic Crossan, Marcus Borg, John Spong and other experts in Christianity. Not the Discovery Institute and their like who are engaged in Christian alchemy.
By that definition, I’m Christian.
And Buddhist.
And Weatherwaxian.
That’s so watered down as to be useless.
Some Samples of the fictional Jesus character from that vile tome, the NT:
(I could have added much more, but became physically ill reading this toxic pile of Christianity’s hero’s violent anti-family insanity)
Jesus’ “Morality”
Matthew:
Families will be torn apart because of Jesus (this is one of the few “prophecies” in the Bible that has
actually come true):
“Brother shall deliver up the brother to death, and the father the child: and the children shall rise up against their parents, and cause them to be put to death.” 10:21
“For I am come to set a man at variance against his father, and the daughter against her mother, and the daughter in law against her mother in law. And a man’s foes shall be they of his own household.” 10:35-36
“He that loveth father or mother more than me is not worthy of me: and he that loveth son or daughter more than me is not worthy of me”. 10:37
When Jesus’ mother and brothers want to see him, Jesus asks, “Who is my mother? Who are my brothers?” So much for Jesus’ family values. 12:47-49
“For whosoever hath, to him shall be given, and he shall have more abundance: but whosoever hath not, from him shall be taken away even that he hath”. 13:12
“God commanded, saying, Honour thy father and mother: and, He that curseth father or mother, let him die the death.” 15:4
In the parable of the unforgiving servant, the king threatens to enslave a man and his entire family to pay for a debt. This practice, which was common at the time, seems not to have bothered Jesus very much. 18:25
Jesus says that divorce is permissible when the wife is guilty of fornication. But what if the husband is unfaithful? Jesus doesn’t seem to care about that. 5:32, 19:9
Abandon your wife and children for Jesus and he’ll give you a big reward. 19:29
“Friend, how camest thou in hither not having a wedding garment? And he was speechless. Then said the king to the servants, Bind him hand and foot, and take him away, and cast him into outer darkness, there shall
be weeping and gnashing of teeth.” 22:12-13
“Woe unto them that are with child, and to them that give suck in those days.” Why? Does God especially hate pregnant and nursing women? 24:19
Mark:
“He that believeth not shall be damned.” 16:16
Luke:
“Suppose ye that I am come to give peace on earth? I tell you, Nay; but rather division” 12:51
John:
“He that believeth not the Son shall not see life; but the wrath of God abideth on him” 3:36
All that ever came before me [Jesus] are thieves and robbers” 10:8
Romans:
“He that doubteth is damned…. For whatever is not of faith is sin” 14:23
Ephesians:
“Servants, be obedient to them that are your masters according to the flesh, with fear and trembling, in singleness of your heart, as unto Christ” 6:5
Colossians
“Servants, obey in all things your masters” 3:22
2 Thessalonians:
“The Lord Jesus … In flaming fire taking vengeance on them that know not God … Who shall be punished
with everlasting destruction” 1:7-9
“Withdraw yourselves from every brother that walketh disorderly, and not after the tradition which he received of us” 3:6
Titus:
“Exhort servants to be obedient unto their own masters, and to please them well in all things” 2:9
2 John:
“If there come any unto you, and bring not this doctrine, receive him not into your house, neither bid him God speed” 10
————
Now, you can claim that you don’t follow any of these, nor the multitude of other travesties, but to then say that you are in some way a “Christian”, is to commit an unforgivable violence upon the English language.
Hey! You can’t just put that out there and not explain it! What is a “non-theist Christian” exactly? Under what previously recognized definition of “Christian” would a non-theist be encompassed? Not looking to ruffle feathers, I’m sincerely curious what the answer is here.
You posted just as I did, OldFuzz. Sorry.
As a non-theist Christian, I do not believe in an Emperor.
LOL
this is Michael Dowd, I’ll bet.
amirite?
The chief problem, Oldfuzz, is that “considerable thinking” about something for which there is “little or now objective evidence” is indistinguishable from fantasy, and can hardly be considered “thought” at all. I suppose you can narrowly define what types of angels and pinheads you are talking about and then remain logically consistent about how many angels can dance on the head of a pin…but that hardly constitutes something science-honoring. As far as debates about “methods for determining species” goes, the debate is not about the species–about the external, objective existence of the organisms–but about how we are best to understand and use a term that can meaningfully capture something about that reality. That is a far cry from, say, debates about the relative composition of Jesus’ nature or what hierarchy might exist within the Trinity. It’s an embarrassing comparison for you to me making, because at best it shows you losing, and losing big, on the field of intellectual endeavor.
Of course it’s a fantasy, that’s what love is, subjective, experience without hard evidence.
Love is subjective?
You bet! You got proof?
That’s a link.
That’s the chemistry that causes the effect. What is love itself?
a definition of a cause and effect related to chemistry.
prove me wrong.
oh, and are you Michael Dowd?
Designing a god to your own specification is worse than being a fundagasicle.
People that can’t see it is all made up and dangerous and stupid are disappointing.
Just suck on it jesus christ.
Changing one’s perspective on anything is the natural evolution of comprehension which includes facts, fantasies and fiction, the composite of those two. It’s a question of one’s perspective, no two of us having the same, and a matter of not imposing one’s perspective on another. Scientists do this all the time with little or no complaint from other scientists.
As was asked here in an earlier posting, “Should the religious be held accountable?” The answer is yes. Everyone should be, but not everyone should hold the identical views. Human growth, especially knowledge, would cease.
Everyone here holds a view they find valid. The question is whether whether opinion is allowed or must everyone be limited to the facts?
Wow, do I regret spending one second on you, Oldfuzz. I was right to start with: You define Christianity pretty much as a pretty poem with no actual content. Whatever. I define Christianity as drinking Stella Artois and masturbating. To borrow an idea from Australian musician/comic Tim Minchin, are ideas so loose-weave that it doesn’t matter whether you use your groundfloor door or your second-story window? If reality is just a matter of ridiculous word-games to you, please don’t waste everyone’s time by pretending to use them. Gawd.
Sorry to have wasted your time, but Christianity, like every religion, theist, non-theist (including atheist) and agnostic is “subject” to individual understanding. That is the slippery slope.
Of course if you can cite a reference supporting your specific definition of Christianity, I will read it.
Sorry to have wasted your time>
Liar.
seriously, are you Michael Dowd?
You’re right, I didn’t waste your time. You did, but I had no intention of being the cause of your spending time on this.
Shorter oldfuzz:
“Religion is a different way of knowing”
That tripe has been debunked countless times.
I didn’t say that and wouldn’t; however, I would say that key objective of religion is the religious experience and described by William James a century ago.
You did say that. That’s exactly the content of what you said in the comment I responded to.
Rob, It may be what you read, but not what I said.
The question is whether whether opinion is allowed or must everyone be limited to the facts?
yeah, I agree with Rob, this is just a different form of the “different ways of knowing” idiom.
everyone is entitled to their opinion. For us to NOT LAUGH at yours, it must be supportable with evidence, however.
some opinions are “not even wrong”
The “Don Cupitt” website, to which Mr. Old Fuzz referred above, includes an essay that applies Rorty’s ideas about “antirepresentationalism” to religion. I offer this information not in hopes of changing anyone’s mind but in hopes that the reflexive name-calling and factual distortions that seem to characterize these “debates” can, in this one instance, be a little better focused. Carry on, friends.
I can haz more strawmenz plz?
Nice try. Thanks. Another of the interesting contemporary religious scholars is Lloyd Geering’s Coming Back to Earth, but I’d check with the library before you go.